Open Access

MicroRNA-33a regulates cholesterol synthesis and cholesterol efflux-related genes in osteoarthritic chondrocytes

  • Fotini Kostopoulou1, 2,
  • Konstantinos N Malizos2, 3,
  • Ioanna Papathanasiou1 and
  • Aspasia Tsezou1, 2, 4Email author
Arthritis Research & Therapy201517:42

https://doi.org/10.1186/s13075-015-0556-y

Received: 20 July 2014

Accepted: 13 February 2015

Published: 5 March 2015

Abstract

Introduction

Several studies have shown that osteoarthritis (OA) is strongly associated with metabolism-related disorders, highlighting OA as the fifth component of the metabolic syndrome (MetS). On the basis of our previous findings on dysregulation of cholesterol homeostasis in OA, we were prompted to investigate whether microRNA-33a (miR-33a), one of the master regulators of cholesterol and fatty acid metabolism, plays a key role in OA pathogenesis.

Methods

Articular cartilage samples were obtained from 14 patients with primary OA undergoing total knee replacement surgery. Normal cartilage was obtained from nine individuals undergoing fracture repair surgery. Bioinformatics analysis was used to identify miR-33a target genes. miR-33a and sterol regulatory element-binding protein 2 (SREBP-2) expression levels were investigated using real-time PCR, and their expression was also assessed after treatment with transforming growth factor-β1 (TGF-β1) in cultured chondrocytes. Akt phosphorylation after treatment with both TGF-β1 and miR-33a inhibitor or TGF-β1 and miR-33a mimic was assessed by Western blot analysis. Furthermore, we evaluated the effect of miR-33a mimic and miR-33a inhibitor on Smad7, a negative regulator of TGF-β signaling, on cholesterol efflux-related genes, ATP-binding cassette transporter A1 (ABCA1), apolipoprotein A1 (ApoA1) and liver X receptors (LXRα and LXRβ), as well as on matrix metalloproteinase-13 (MMP-13), using real-time PCR.

Results

We found that the expression of miR-33a and its host gene SREBP-2 was significantly elevated in OA chondrocytes compared with normal chondrocytes. Treatment of cultured chondrocytes with TGF-β1 resulted in increased expression of both miR-33a and SREBP-2, as well as in rapid induction of Akt phosphorylation, whereas TGF-β-induced Akt phosphorylation was enhanced by miR-33a and suppressed by inhibition of miR-33a, as a possible consequence of Smad7 regulation by miR-33a. Moreover, treatment of normal chondrocytes with miR-33a resulted in significantly reduced ABCA1 and ApoA1 mRNA expression levels and significantly elevated MMP-13 expression levels, promoting the OA phenotype, whereas miR-33a’s suppressive effect was reversed using its inhibitor.

Conclusions

Our findings suggest, for the first time to our knowledge, that miR-33a regulates cholesterol synthesis through the TGF-β1/Akt/SREBP-2 pathway, as well as cholesterol efflux-related genes ABCA1 and ApoA1, in OA chondrocytes, pointing to its identification as a novel target for ameliorating the OA phenotype.

Introduction

Osteoarthritis (OA), the most common form of arthritis, is a chronic degenerative joint disease that affects millions of people worldwide [1]. It is thought of as a “joint failure” due to molecular changes that take place in all joint tissues [2]. OA is a complex disorder in which increased mechanical load and inflammation, combined with genetic predisposition, trauma and obesity, contribute to its initiation and progression [3].

OA is now considered as a disease with a variety of phenotypes, including the metabolic phenotype, because OA and the metabolic syndrome (MetS) are tied together in fundamental ways [4]. Their association is further supported by a number of studies linking OA to hypertension, type 2 diabetes and dyslipidemia, all characteristics of MetS [4,5], whereas common molecules seem to be involved in the pathophysiology of both OA and metabolic disturbances, highlighting OA as a new facet of MetS [6].

Imbalances of lipid traffic or metabolic homeostasis may either contribute to or represent the primary disruption associated with the development of many lipid-related diseases [7]. In that regard, our group has previously investigated the metabolic aspect of OA by studying the involvement of adipokines and lipid-related genes in its pathogenesis. Osteoarthritic chondrocytes were found to internalize lipids and exhibit reduced expression of genes regulating reverse cholesterol transport, such as ATP-binding cassette transporter A1 (ABCA1), apolipoprotein A1 (ApoA1), or their transcriptional regulators liver X receptors (LXRα and LXRβ), resulting in advanced cell toxicity due to accumulation of cholesterol [8-10].

Under normal conditions, biosynthesis of cholesterol is directly regulated by the cholesterol levels present. In OA, we have recently shown that sterol regulatory element-binding protein 2 (SREBP-2), a transcription factor that activates genes of cholesterol metabolism and biosynthesis, such as 3-hydroxy-3-methylglutaryl-coenzyme A reductase, was significantly elevated. We also provided evidence for its induction by transforming growth factor-β1 (TGF-β1) through the phosphoinositide 3-kinase (PI3K)/Akt pathway, a molecular mechanism responsible for the increase in cholesterol synthesis observed in OA [11].

All of the above information suggests that both processes—cholesterol synthesis and cholesterol efflux—are deregulated and contribute to OA pathogenesis. However, so far, the underlying mechanisms for their interaction remain unknown.

In an attempt to open novel avenues in therapeutic strategies for OA, a lot of studies have focused on microRNAs (miRNAs), a rapidly evolving research field. miRNAs are small (20 to 24 nucleotides long), noncoding RNAs that control gene expression at the posttranscriptional level. The mature miRNAs bind to specific, fully or partially complementary sequences in the 3′ untranslated regions (3′-UTRs) of mRNA targets and promote their degradation or prohibit their translation into functional proteins [12-14]. In rare cases, the interaction of miRNAs with a target mRNA takes place at the 5′-UTR or at protein-coding regions [14]. Most miRNA target sites have perfect pairing to the region near the miRNA 5′ end (seed region) or to the region near the miRNA 3′ end (3′ compensatory pairing). Interestingly, “centered pairing,” a unique class of miRNA target sites, has been identified, in which the interaction between miRNA and mRNA takes place in the central region of the miRNA [15].

Recent studies have identified the expression profiles of miRNAs that regulate matrix genes or signaling pathways pertinent to OA [16-20], with specific miRNAs related to both cartilage and adipose tissue biology [20,21]. miRNA-33a (miR-33a) is highly conserved in many animal species and is one of the master regulators of cholesterol and fatty acid metabolism [22], and it is located within intron 16 of the human SREBP2 gene. It regulates the expression of genes involved in cholesterol export and high-density lipoprotein (HDL) biogenesis (ABCA1, ABCG1 and NPC1) [23-25], fatty acid oxidation (CPT1A, CROT, HADHB and AMPKa), bile secretion (ABCB11 and ATP8B1) and insulin signaling (IRS2 and SIRT6) [26-28]. More specifically, miR-33a has been demonstrated to have an essential effect on regulating cholesterol metabolism in cooperation with its host gene, SREBP2, by strongly repressing the levels of ABCA1 and thus dampening cellular cholesterol efflux to ApoA1 in human and murine macrophages and hepatic cells. Contrarily, inhibition of endogenous miR-33a increases plasma HDL levels through positive regulation of ABCA1 expression [23,25,29-31], serving as useful tool for treating dyslipidemia, cardiovascular disorders and related metabolic diseases.

However, the role of miR-33a in regulating cholesterol homeostasis in OA has not been investigated yet. In this study, we demonstrate that miR-33a expression levels are significantly increased in OA chondrocytes compared with normal chondrocytes, being induced by TGF-β1, and that this miRNA regulates cholesterol synthesis and cholesterol efflux-related genes in OA chondrocytes.

Methods

Bioinformatics approaches

The online miRNA databases TargetScan 6.2 [32], miRanda [33] and miRDB [34] were used to search miR-33a target genes.

Osteoarthritic and normal articular cartilage samples

Cartilage tissues were aseptically obtained from patients with primary OA undergoing total knee replacement surgery at the Department of Orthopaedics of University Hospital of Larissa. A total of 14 patients were included in this study (11 women and 3 men; mean age: 69.9 ± 7.3 years). Radiographs were obtained before surgery and graded using the Kellgren-Lawrence system according to the following criteria: grade 1 (doubtful narrowing of joint space and possible osteophytes), grade 2 (definite osteophytes and possible narrowing of joint space), grade 3 (moderate multiple osteophytes, definite narrowing of joint space and some sclerosis and possible deformity of bone ends) and grade 4 (large osteophytes, marked narrowing of joint space, severe sclerosis and definite deformity of bone ends). All patients had a Kellgren-Lawrence grade ≥2. The assessment of the radiographs by two independent expert observers was blinded. Patients with rheumatoid arthritis and other autoimmune diseases, as well as chondrodysplasias, infection-induced OA and posttraumatic OA, were not included in the study. Normal articular cartilage was obtained from nine individuals (five women and four men; mean age: 66 ± 4.4 years) undergoing fracture repair surgery who had no history of joint disease and did not show clinical manifestations compatible with OA when this was specifically explored by radiographs. Both patients’ and healthy individuals’ cartilage samples were obtained upon their providing written informed consent. The method of obtaining consent was approved by the Institutional Review Board of the University Hospital of Larissa. The study protocol conformed to the ethical guidelines of the 1975 Declaration of Helsinki as reflected in a priori approval by the local ethics committee of the University Hospital of Larissa.

Primary cultures of normal and osteoarthritic articular chondrocytes

Cartilage samples were cut into small pieces with a scalpel and digested at 37°C with 1 mg/ml pronase (Roche Applied Science, Mannheim, Germany) for 30 minutes, and then each sample was centrifuged and the pellet was incubated with 1 mg/ml collagenase P (Roche Applied Science) for 3 hours at 37°C. Chondrocytes were counted and checked for viability by trypan blue staining. More than 95% of the cells were viable after isolation. The isolated chondrocytes were seeded in 25-cm2 culture flasks and incubated with Dulbecco’s modified Eagle’s medium/Ham’s F-12 (DMEM/F-12) (GIBCO; Life Technologies, Paisley, UK) plus 5% fetal bovine serum (GIBCO; Life Technologies) and 100 U/ml penicillin-streptomycin (HyClone Laboratories, Logan, UT, USA) at 37°C in an atmosphere of 5% CO2 until reaching confluence.

RNA extraction

Total cellular RNA containing miRNA was extracted from cultured chondrocytes using TRIzol reagent (Invitrogen/Life Technologies). RNA was further purified using an RNeasy Mini Kit (Qiagen, Hilden, Germany). Preservation of 28S and 18S rRNA species was used to assess RNA integrity. All the samples included in the study had prominent 28S and 18S rRNA components. The yield was quantified spectrophotometrically.

Reverse transcription

For RT-PCR experiments, 1 μg of RNA from each sample was used. Reverse transcription was conducted using the SuperScript III Reverse Transcriptase kit (Invitrogen/Life Technologies) according to the protocol provided by the manufacturer. Osteoarthritic and normal chondrocyte samples were reverse-transcribed using random primers (Invitrogen/Life Technologies), miR-33a stem-loop RT primer (5 pmol in 20-μl reaction volume) or U6 small nuclear RNA (RNU6B) stem-loop RT primer (5 pmol in 20-μl reaction volume) to generate the cDNA according to the method described by Chen et al. [35]. Stem-loop primers carried a 3′ overhang of six or seven nucleotides complementary to the 3′ portion of the respective mature miRNA sequence.

Quantitative RT-PCR

Expression of ABCA1, ApoA1, LXRα, LXRβ, SREBP-2, matrix metalloproteinase (MMP)-13, Smad7, glyceraldehyde 3-phosphate dehydrogenase (GAPDH), mature miR-33a and RNU6B was determined by real-time PCR (ABI 7300; Applied Biosystems, Foster City, CA, USA). Reactions were done in triplicate using 2 μl of cDNA per reaction. The reactions for miRNA or mRNA were performed in a 10-μl final volume containing 2 μl of cDNA (conducted with stem-loop primer (dilution 1:100) or with random primers (dilution 1:5)), 5 μl of Power SYBR Green PCR Master Mix (Applied Biosystems), 0,3 μl of each primer (forward and reverse) and 2.4 μl of nuclease-free water. All primers used are shown in Table 1. To quantify the relative expression of each miRNA or gene, threshold cycle (C t) values were normalized against the endogenous reference (ΔC t = C t (miR-33a) − C t (U6)) or ΔC t = C t (target) − C t (GAPDH)) and were compared with a calibrator using the 2−ΔΔCt method (2−ΔΔCt = ΔC t (sample) − ΔC t (calibrator)).
Table 1

Oligonucleotide primers used in cDNA synthesis for the detection of miR-33a and U6 (stem-loop primers) and for real-time quantitative PCR assay a

 

RT-qPCR stem-loop primer

miR-33a

5′-TGGATATCCACACCAGGGTCCGAGGTATTCGGTGTGGATATCCATGCAATG

U6

5′-CACGGAAGCCCTCACACCGTGTCGTTC

Gene

Forward primer sequence

Reverse primer sequence

miR-33a

CGCGCGTGCATTGTAGTTG

CACCAGGGTCCGAGGT

U6

GCTTCGGCAGCACATATACTAAAAT

CTCACACCGTGTCGTTCCA

SREBP2

AAGTCTGGCGTTCTGAGGAA

AGGTCCACCTCATTGTCCAC

ABCA1

GGAGGCAATGGCACTGAGGAA

CCTGCCTTGTGGCTGGAGTGT

ApoA1

ATGAAAGCTGCGGTGCTGACC

CACCTTCTGGCGGTAGAGCTCC

LXRα

CCGCCTGAAGAAACTGAA

CGAAGCCGGTCAGAAAAG

LXRβ

CGCTACAACCACGAGACAGA

GTGGAAGTCGTCCTTGCTGT

MMP-13

TGGCATTGCTGACATCATGA

GCCAGAGGGCCCATCAA

Smad7

TCCAGATACCCGATGGATTTTC

GATTTTGCTCCGCACCTTCT

GAPDH

GAGTCAACGGATTTGGTCGT

GACAAGCTTCCCGTTCTCAG

aABCA1, ATP-binding cassette transporter A1; ApoA1, Apolipoprotein A1; GAPDH, Glyceraldehyde 3-phosphate dehydrogenase; LXR, Liver X receptor; miR-33a, MicroRNA-33a mature; MMP-13, Matrix metalloproteinase-13; SREBP2, Sterol regulatory element-binding protein 2.

Protein extraction and Western blot analysis

Chondrocytes were lysed using lysis buffer containing 30 mM Tris (pH 7.5), 150 mM NaCl, 10% glycerol, 1% Nonidet P-40 and a cocktail of protease and phosphatase inhibitors (Roche Applied Science). Protein concentration was quantified using the Bradford protein assay (Bio-Rad Laboratories, Hercules, CA, USA) with bovine serum albumin as standard. Cell lysates from chondrocytes were electrophoresed and separated on 10% acrylamide gels and transferred to polyvinylidene fluoride membranes (EMD Millipore, Billerica, MA, USA) that were probed with anti-total Akt (Santa Cruz Biotechnology Europe, Heidelberg, Germany) and anti-p-Akt (Abcam, Cambridge, UK). Signals were detected using suitable immunoglobulin G conjugated with horseradish peroxidase. Western blot bands were quantified using ImageJ software (National Institutes of Health, Bethesda, MD, USA).

Treatment with TGF-β1

Primary cultured human chondrocytes were seeded onto six-well plates at a density of 3 × 105 cells/well. Three days postseeding, normal chondrocytes were serum-starved overnight and then cultured in serum-free DMEM/F-12 in the presence or absence of 10 ng/ml TGF-β1 (Sigma-Aldrich, St Louis, MO, USA) for 0.5 hours, 2 hours, 6 hours, 24 hours and 48 hours. Each experiment was conducted in triplicate, and the results from three wells were averaged and considered as n = 1. RNA was extracted, and real-time PCR analysis was performed (6 hours, 24 hours, 48 hours). Total and phospho-proteins were extracted, and Western blot analysis was performed (0.5 hours, 2 hours, 24 hours).

TGF-β1 treatment in normal chondrocytes with subsequent use of miR-33a inhibitor

Cells were seeded onto six-well plates at a density of 3 × 105cells/well. Three days postseeding, normal chondrocytes were serum-starved overnight and then cultured in serum-free DMEM/F-12 in the presence or absence of 10 ng/ml TGF-β1 (Sigma-Aldrich) for 6 hours. After 6-hour culture of normal chondrocytes with TGF-β1, the culture medium was changed and treated with 50 nM anti-miR-33a or negative control for 24 hours. Each experiment was conducted in duplicate, and the results from two wells were averaged and considered as n = 1. RNA was extracted, and real-time PCR analysis was performed.

Transient transfection of microRNA mimic and inhibitor

miRNA mimic (miR-33a), antagomir (anti-miR-33a) or negative control oligonucleotides were obtained from Ambion/Life Technologies. Primary cultured normal human chondrocytes were transfected with 30 nM miR-33a mimic using Lipofectamine 2000 reagent (Invitrogen/Life Technologies) for 6 hours, 24 hours and 48 hours. miR-33a inhibitor (50 nM) was transfected into human osteoarthritic chondrocytes for 24 and 48 hours. Each experiment was conducted in triplicate, and the results from three wells were averaged and considered as n = 1. RNA was extracted, and real-time PCR was performed as previously described.

Transient transfection of microRNA inhibitor with subsequent TGF-β1 treatment and transient transfection of miR-33a mimic plus TGF-β1 in human chondrocytes

Cells were seeded onto six-well plates at a density of 3 × 105cells/well. Three days postseeding, OA chondrocytes were serum-starved overnight and then cultured in serum-free DMEM/F-12 in the presence or absence of 50 nM anti-miR-33a for 24 hours. The culture medium was changed and treated with 10 ng/ml TGF-β1 (Sigma-Aldrich) for 2 hours. Normal chondrocytes were serum-starved overnight and then cultured in serum-free DMEM/F-12 in the presence or absence of 30 nM miR-33a and 10 ng/ml TGF-β1 (Sigma-Aldrich) or 10 ng/ml TGF-β1 alone for 24 hours. Each experiment was conducted in duplicate, and the results from two wells were averaged and considered as n = 1. Total and phospho-proteins were extracted, and Western blot analysis was performed.

Statistical analysis

All statistical analysis was performed using SPSS Statistics 20 software (IBM, Armonk, NY, USA). Gene expression data were analyzed using Student’s t-test and a confidence level of 95%. Numerical data were expressed as mean ± standard error mean (SEM). P < 0.05 was considered statistically significant.

Results

miR-33a expression is elevated in OA chondrocytes

There is evidence that intronic miRNAs are coordinately expressed and processed with the precursor mRNA in which they reside [36]. Taking into consideration the fact that miR-33a is located within intron 16 of the human SREBP2 gene and that SREBP2 expression is upregulated in OA [11], we wanted to test whether miR-33a and its host gene SREBP2 are coexpressed in human chondrocytes. We evaluated their expression levels by quantitative RT-PCR and found that they were both significantly elevated in OA chondrocytes compared with normal chondrocytes (P < 0.05) (Figure 1A,B).
Figure 1

MicroRNA-33a is elevated in osteoarthritic chondrocytes and is induced by transforming growth factor-β1. (A) Relative expression of microRNA (miR)-33a in normal and osteoarthritic (OA) chondrocytes (n = 9 for normal chondrocytes from 9 different donors, n = 14 for OA chondrocytes from 14 different donors). U6 was used for normalization of the real-time PCR data. The data are expressed as mean and standard error of the mean (SEM) of three independent experiments, each of which was run in duplicate. *P < 0.05 as measured using an unpaired Student’s t-test. (B) Relative expression of sterol regulatory element-binding protein 2 (SREBP-2) in normal and OA chondrocytes (n = 5 for normal chondrocytes from 5 different donors, n = 10 for OA chondrocytes from 10 different donors). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of three independent experiments, each of which was run in duplicate. *P < 0.05 as measured using an unpaired Student’s t-test. (C) and (D) miR-33a expression levels in cultured normal chondrocytes (n = 4 from 4 different donors) following treatment with 10 ng/ml transforming growth factor (TGF)-β1 for 6 hours, 24 hours (C) and 48 hours (D). U6 was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of two independent experiments, each of which was run in triplicate. *P < 0.05 compared with control. (E) and (F) SREBP-2 expression levels in cultured normal chondrocytes (n = 5 from 5 different donors) following treatment with 10 ng/ml TGF-β1 for 6 hours, 24 hours (E) and 48 hours (F). GAPDH was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of two independent experiments, each of which was run in triplicate. *P < 0.05 compared with control.

TGF-β1 induces miR-33a expression in human chondrocytes

We have recently shown that SREBP-2 is activated by TGF-β1 in human chondrocytes through the integrin alpha-V/PI3K/Akt pathway [11]. We next proceeded to investigate whether miR-33a expression is also induced by this growth factor. Normal chondrocytes were treated with 10 ng/ml TGF-β1 for 6 hours, 24 hours and 48 hours, and we found that both miR-33a and SREBP-2 expression levels were significantly upregulated in chondrocytes treated with TGF-β1 compared with untreated cells (P < 0.05) (Figure 1C–F).

Regulation of SREBP-2 expression by anti-miR-33a in TGF-β1-induced chondrocytes

Because TGF-β1 was found to upregulate SREBP-2 and miR-33a, normal chondrocytes were treated with 10 ng/ml TGF-β1 for 6 hours. After that period of time, chondrocytes were transfected with 50 nM miR-33a inhibitor (anti-miR-33a) for 24 hours. Our results showed that SREBP-2 expression levels were reduced in chondrocytes treated with 10 ng/ml TGF-β1 together with 50 nM anti-miR-33a compared with TGF-β1 treatment (P < 0.001) (Figure 2A).
Figure 2

Effect of microRNA-33a on transforming growth factor-β1-mediated phosphoinositide 3-kinase/Akt signaling pathway in human chondrocytes. (A) Sterol regulatory element-binding protein 2 (SREBP-2) mRNA expression in human normal chondrocytes (n = 3 from 3 different donors) after treatment with 10 ng/ml transforming growth factor (TGF)-β1 with or without microRNA (miR)-33a inhibitor. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization of the real-time PCR data. The data are expressed as mean and SEM from triplicates of one representative of three experiments. *P < 0.05 versus negative control, **P < 0.01, #TGF-β1 with miR-33a inhibitor versus TGF-β1. (B) Western blot showing phosphorylated (p-Akt) and total Akt protein expression levels in normal chondrocytes treated with 10 ng/ml TGF-β1 for 0.5, 2 and 24 hours. (C) Diagram showing p-Akt protein expression normalized to total Akt using ImageJ software. The result shown represents the mean from three different blots. *P < 0.05 compared with control. (D) Western blot showing p-Akt and total Akt protein expression levels in normal chondrocytes treated with TGF-β1, TGF-β1 plus miR-33a or negative control. (E) Diagram showing p-Akt protein expression normalized to total Akt using ImageJ software. The result shown represents the mean from three different blots. *P < 0.05 compared with control. #TGF-β1 with miR-33a versus TGF-β1. (F) Western blot showing p-Akt and total Akt protein expression levels in osteoarthritis chondrocytes treated with TGF-β1 and miRNA inhibitor (anti-miR-33a), followed by treatment of TGF-β1 or negative control. (G) Diagram showing p-Akt protein expression normalized to total Akt using ImageJ software. The result shown represents the mean from three different blots. *P < 0.05 compared with control. #TGF-β1 with miR-33a inhibitor versus TGF-β1.

PI3K/Akt pathway is directly associated with TGF-β receptor

To show whether the PI3K/Akt pathway is directly or indirectly associated with the TGF-β receptor, we treated normal chondrocytes with 10 ng/ml TGF-β1 over different periods of time (from 0.5 to 24 hours) and found a rapid induction of Akt phosphorylation, suggesting direct involvement of PI3K in TGF-β-receptor induced intracellular signaling (Figure 2B,C).

Regulation of TGF-β1-induced Akt phosphorylation by miR-33a

Because miR-33a expression was significantly increased by TGF-β1 stimulation in human chondrocytes and its inhibition reduced SREBP-2 expression levels, we were prompted to investigate miR-33a’s role in the PI3K/Akt pathway. Transfection of normal chondrocytes with 10 ng/ml TGF-β1 plus 30 nM miR-33a for 24 hours resulted in significant increased Akt phosphorylation compared with TGF-β1 treatment alone (Figure 2D,E). Inhibition of miR-33a in human chondrocytes inhibited TGF-β1-induced Akt phosphorylation. Total Akt expression was not changed by transfection of miR-33a or miR-33a inhibitor (Figure 2F,G).

miR-33a modulates TGF-β1 induced PI3K/Akt signaling pathway by targeting Smad7

Taking into consideration the fact that the degree of activation of the TGF-β signaling pathways is subject to regulation by a large number of intracellular and extracellular agonists and antagonists, including Smad7 and Smurf, we performed computational analysis of the 3′ UTR of Smad7 mRNA, a negative regulator of TGF-β signaling. The TargetScan 6.2 and miRanda prediction tools showed that Smad7 is a target gene of miR-33a (Figure 3A).
Figure 3

ΜicroRNA-33a affects Smad7 expression in human chondrocytes. (A) TargetScan 6.2 and miRanda identified one conserved sequence in the 3′ untranslated region of human Smad7 mRNA that was completely complementary to microRNA (miR)-33a. (B) Relative expression levels of miR-33a in normal human chondrocytes (n = 3 from 3 different donors) transfected with miR-33a mimic or negative control. U6 was used for normalization of the real-time PCR data. The data are expressed as mean and standard error of the mean (SEM) of three independent experiments, each of which was run in duplicate. *P < 0.05 versus negative control. (C) Relative expression levels of Smad7 mRNA 24 hours after transfection of 30 nM miR-33a or negative control in normal human chondrocytes (n = 6 from 6 different donors). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of three independent experiments, each of which was run in triplicate. *P < 0.05 versus negative control. (D) Relative expression levels of miR-33a in human osteoarthritis (OA) chondrocytes transfected with miR-33a inhibitor or negative control (n = 3 from 3 different donors). U6 was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of three independent experiments, each of which was run in duplicate. *P < 0.05 versus negative control. (E) Relative expression levels of Smad7 mRNA 24 hours after transfection of 50 nM anti-miR-33a or negative control in human OA chondrocytes (n = 4 from 4 different donors). GAPDH was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of three independent experiments, each of which was run in triplicate. *P < 0.05 versus negative control.

To verify this prediction, we transfected normal chondrocytes with 30 nM miR-33a mimic for 24 hours. Treatment of normal chondrocytes with miR-33a mimic resulted in significant upregulation of miR-33a expression levels compared with negative control (P < 0.05) (Figure 3B). We observed a significant reduction in Smad7 mRNA expression compared with untreated cells (P < 0.05) (Figure 3C). Treatment of OA chondrocytes with 50 nM miR-33a inhibitor resulted in significant suppression of miR-33a (Figure 3D) (P < 0.05) and in significantly increased Smad7 mRNA expression levels compared with negative control (P < 0.05) (Figure 3E).

Computational prediction of miR-33a lipid-related target genes

To investigate the role of miR-33a in regulating lipid-related genes, we used bioinformatics prediction tools, which identified three conserved sequences in the 3′-UTR of human ABCA1 mRNA that were completely complementary to miR-33a (Figure 4A). None of the other genes examined (ApoA1, SREBP2, LXRα, LXRβ) had a fully or partially complementary sequence to miR-33a (data not shown).
Figure 4

ΜicroRNA-33a affects ATP-binding cassette transporter A1 and apolipoprotein A1 expression in human chondrocytes. (A) TargetScan 6.2, miRanda and miRDB identified three conserved sequences in the 3′ untranslated region of human ATP-binding cassette transporter A1 (ABCA1) mRNA that were completely complementary to microRNA (miR)-33a. (B) and (C) Relative expression levels of ABCA1 (B) and apolipoprotein A1 (ApoA1) (C) mRNA at 6, 24 and 48 hours after transfection of 30 nM miR-33a or negative control in normal human chondrocytes (n = 6 from 6 different donors). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization of the real-time PCR data. The data are expressed as mean and standard error of the mean (SEM) of two independent experiments, each of which was run in triplicate. *P < 0.05 versus negative control. (D) Relative expression levels of matrix metalloproteinase (MMP)-13 mRNA at 6, 24 and 48 hours after transfection of 30 nM miR-33a or negative control in normal human chondrocytes (n = 4 from 4 different donors). GAPDH was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of two independent experiments, each of which was run in triplicate. *P < 0.05 versus negative control. (E) and (F) Relative expression levels of liver X receptor α (LXRα) (E) and LXRβ (F) mRNA at 6, 24 and 48 hours after transfection of 30 nM miR-33a or negative control in normal human chondrocytes (n = 4 from 4 different donors). GAPDH was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of two independent experiments, each of which was run in triplicate. NS, Not significant.

miR-33a targets to ATP-binding cassette transporter A1 and suppresses its expression in human chondrocytes

To examine the role of miR-33a in the expression of genes regulating reverse cholesterol transport (ABCA1, ApoA1, LXRα and LXRβ), normal chondrocytes were transfected with 30 nM miR-33a mimic for 6 , 24 and 48 hours. miR-33a treatment significantly suppressed ABCA1 mRNA expression levels at 6, 24 and 48 hours (P < 0.05) (Figure 4B), as well as ApoA1 mRNA expression levels at 24 and 48 hours (P < 0.05) (Figure 4C), which was accompanied by elevated levels of MMP-13 (P < 0.05) (Figure 4D). Transfection of miR-33a mimic had no effect on the expression levels of LXRα and LXRβ in human chondrocytes (P > 0.05) (Figure 4E,F).

Anti-miR-33a induces ATP-binding cassette transporter A1 expression in human chondrocytes

To confirm that miR-33a regulates cholesterol efflux-related genes in a manner that can be reversed by its inhibitor, OA chondrocytes were treated with 50 nM anti-miR-33a for 24 and 48 hours, and expression levels of ABCA1, ApoA1 and MMP-13 were evaluated. Treatment of OA chondrocytes with anti-miR-33a resulted in significantly upregulated ABCA1 and ApoA1 mRNA expression levels (P < 0.05) (Figure 5A,B), whereas MMP-13 mRNA expression levels were reduced (P < 0.05) (Figure 5C).
Figure 5

Anti-microRNA-33a affects ATP-binding cassette transporter A1 and apolipoprotein A1 expression in human chondrocytes. (A) Relative expression levels of ATP-binding cassette transporter A1 (ABCA1) mRNA 24 and 48 hours after transfection of 50 nM anti-microRNA (miR)-33a or negative control in human osteoarthritis (OA) chondrocytes (n = 5 from 5 different donors). Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) was used for normalization of the real-time PCR data. The data are expressed as mean and standard error of the mean (SEM) of two independent experiments, each of which was run in triplicate. *P < 0.05 versus negative control. (B) Relative expression levels of apolipoprotein A1 (ApoA1) mRNA 24 and 48 hours after transfection of 50 nM anti-miR-33a or negative control in human OA chondrocytes (n = 5 from 5 different donors). GAPDH was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of two independent experiments, each of which was run in triplicate. *P < 0.05 versus negative control. (C) Relative expression levels of matrix metalloproteinase (MMP)-13 mRNA 24 and 48 hours after transfection of 50 nM anti-miR-33a or negative control in human OA chondrocytes (n = 5 from 5 different donors). GAPDH was used for normalization of the real-time PCR data. The data are expressed as mean and SEM of two independent experiments, each of which was run in triplicate. *P < 0.05 versus negative control.

Discussion

A growing body of evidence suggests that the relationship between MetS and OA is not one of cause and effect, but rather is indicative of an underlying common set of factors, highlighting OA as a metabolic disorder [3-6,10,37-39]. miRNAs have key roles in modulating and maintaining normal physiological conditions, with their signaling emerging as of great interest as a potential tool for diagnosis of and therapy for the progression of a number of diseases, such as OA.

miR-33a plays a crucial role in controlling cholesterol homeostasis in metabolism-related disorders [26], but so far no association with OA has been found. It is embedded within intron 16 of SREBP2, a lipid metabolism-related gene, which has been identified by our group to be involved in OA pathogenesis [11].

In the present study, we investigated the role of miR-33a in cholesterol synthesis and cholesterol efflux-related genes. We found that miR-33a expression levels were significantly elevated in osteoarthritic chondrocytes compared with normal chondrocytes, in accordance to SREBP-2 upregulation. In line with previous findings in human and mouse tissues, such as HEK293 cells, Hep3B human hepatoma cells and mouse peritoneal macrophages [23,29,30,40], our results also suggest that miR-33a is coexpressed with its host gene in human chondrocytes.

As we previously reported that SREBP-2 can be induced by TGF-β1 in chondrocytes, we proceeded to investigate whether TGF-β1 activates miR-33a as well. We found that miR-33a expression was increased in a time-dependent manner after TGF-β1 activation, suggesting that the expression levels of miR-33a and SREBP-2 are coregulated by TGF-β1 at the transcriptional level. This finding is in accordance with recent studies which showed that the expression of both miR-33a and SREBP-2 was increased in a dose- and time-dependent way after TGF-β1 stimulation in immortalized human hepatic stellate cells. We also showed that normal chondrocytes stimulated with TGF-β1, followed by transient transfection of anti-miR-33a, exhibited reduced expression levels of SREBP-2, supporting the strong association between SREBP-2 and its intronic miRNA, miR-33a [23,29,30].

Furthermore, we have also previously shown that the induction of SREBP-2 by TGF-β1 in human chondrocytes is mediated through the PI3K/Akt pathway [11]. To show whether the PI3K/Akt pathway is directly or indirectly associated with the TGF-β receptor, we treated normal chondrocytes with TGF-β1 and found rapid induction of Akt phosphorylation, supporting the direct involvement of PI3K in TGF-β receptor-induced intracellular signaling [41,42]. This pathway is important in regulating the production of MMPs by chondrocytes [43]. It has also been suggested to be implicated in different pathological conditions, cancer, diabetes, viral infections [44] and, more recently, hepatic fibrosis, and thus it is an important player in the regulation of lipid metabolism [45]. We found that transient transfection of human chondrocytes with miR-33a plus TGF-β1 and enhanced Akt phosphorylation, whereas inhibition of miR-33a resulted in subsequent inhibition of TGF-β1-induced Akt phosphorylation. Our previous result is in accordance with the study by Li et al., who reported that inhibition of miR-33a in LX-2 cells inhibited the phosphorylation of Akt after TGF-β1 treatment [45]. The above findings suggest the involvement of miR-33a in the regulation of the TGF-β1/PI3K/Akt/SREBP-2 signaling pathway responsible for increased cholesterol synthesis in OA.

A growing amount of evidence has demonstrated that a large number of intracellular and extracellular activators and inhibitors regulate the degree of activation of the TGF-β signaling pathways. Among them, Smad7, an inhibitory Smad, is a key regulator of TGF-β signaling [42,46-48]. In the present study, we showed that miR-33a targets Smad7 in human chondrocytes, suggesting that miR-33a possibly regulates TGF-β1/PI3K/Akt signaling through modulating Smad7 expression. Interestingly, Huang et al. [49] recently demonstrated that Smad7 is targeted by miR-33a in LX-2 cells, thus highlighting its inhibition as a possible mechanism responsible for miR-33a profibrogenic effects in hepatic stellate cells. In an attempt to investigate the role of miR-33a in the regulation of reverse cholesterol transport, we investigated its effect in the cholesterol efflux-related genes ABCA1, ApoA1, LXRα and LXRβ. Taking into consideration the facts that ABCA1 and ApoA1 expression levels were previously shown by our group to be significantly reduced in OA chondrocytes compared with normal chondrocytes [10] and that ABCA1 is a direct and specific target of miR-33a, as evidenced by previous studies [23-25,28] and by our bioinformatics analysis, we investigated the effect of this miRNA on genes regulating cholesterol efflux in chondrocytes. We found that treatment of normal chondrocytes with miR-33a resulted in significant reduction of ABCA1 and ApoA1 mRNA expression levels, accompanied by increased levels of MMP-13. As evidenced by bioinformatics analysis, miR-33a is fully complementary to the 3′-UTR of ABCA1, directly resulting in degradation of ABCA1’s mRNA transcripts. As ApoA1 is not a target gene of miR-33a, the reduced expression we observed after miR-33a treatment in normal chondrocytes could be considered an indirect effect caused by the inhibition of ABCA1. Interestingly, miR-33a had no effect on LXRα and LXRβ expression levels, as we showed by bioinformatics analysis that there are no binding sites on the LXRα and LXRβ gene regions for this miRNA. On the basis of our results, miR-33a emerges as part of a different regulatory mechanism of genes involved in cholesterol efflux, apart from the traditional ligand-activated transcription factor LXR, providing novel evidence of the contribution of miR-33a to the blockage of reverse cholesterol transport in human chondrocytes.

To confirm that miR-33a regulates cholesterol efflux genes in a way that can be reversed by its inhibitor, we treated OA chondrocytes with anti-miR-33a. Introduction of antisense oligonucleotides directed against miR-33a indeed resulted in strongly increased ABCA1 and ApoA1 expression levels, and it also caused reduced expression of MMP-13, the most abundantly expressed catabolic gene in OA. The above findings are consistent with the reported regulation of ABCA1 by miR-33a in cell lines such as human HepG2 liver carcinoma cells, IMR-90 normal human fibroblasts and the mouse macrophage cell line J774 [24]. Moreover, in studies in animal models of hypercholesterolemia and atherosclerosis, researchers have reported that miR-33a suppresses the expression of ABCA1 and lowers HDL levels, whereas inhibition of miR-33 increases ABCA1 and HDL levels [25,30,31].

Conclusions

We provide novel evidence for the implication of miR-33a, a SREBP-2 intronic miRNA, in OA pathogenesis, identifying it as a dual regulator of cholesterol synthesis and cholesterol efflux-related genes in OA chondrocytes, suggesting its potential use as a novel target for the amelioration of the OA phenotype.

Abbreviations

ABCA1: 

ATP-binding cassette transporter A1

Anti-miR-33a: 

MicroRNA-33a antagomir

ApoA1: 

Apolipoprotein A1

DMEM: 

Dulbecco’s modified Eagle’s medium

GAPDH: 

Glyceraldehyde 3-phosphate dehydrogenase

HDL: 

High-density lipoprotein

LXR: 

Liver X receptor

miR-33a: 

MicroRNA-33a

miRNA: 

MicroRNA

MMP: 

Matrix metalloproteinase

OA: 

Osteoarthritis

PI3K: 

Phosphoinositide 3-kinase

RNU6B: 

U6 small nuclear RNA

SEM: 

Standard error of the mean

SREBP-2: 

Sterol regulatory element-binding protein 2

TGF-β1: 

Transforming growth factor-β1

UTR: 

Untranslated region

Declarations

Acknowledgements

The study was partly financed by the research committee of the University of Thessaly, Greece.

Authors’ Affiliations

(1)
Department of Cytogenetics and Molecular Genetics, School of Medicine, University of Thessaly
(2)
Center for Research and Technology Hellas (CERTH)
(3)
Department of Orthopaedics, School of Medicine, University of Thessaly
(4)
Department of Biology, School of Medicine, University of Thessaly

References

  1. Lawrence RC, Felson DT, Helmick CG, Arnold LM, Choi H, Deyo RA, et al. Estimates of the prevalence of arthritis and other rheumatic conditions in the United States: part II. Arthritis Rheum. 2008;58:26–35.View ArticlePubMed CentralPubMedGoogle Scholar
  2. Goldring S, Lane N, Sandell L. Foreword: osteoarthritis. Bone. 2012;51:189.View ArticlePubMedGoogle Scholar
  3. Bijlsma JW, Berenbaum F, Lafeber FP. Osteoarthritis: an update with relevance for clinical practice. Lancet. 2011;377:2115–26.View ArticlePubMedGoogle Scholar
  4. Sellam J, Berenbaum F. Is osteoarthritis a metabolic disease? Joint Bone Spine. 2013;80:568–73.View ArticlePubMedGoogle Scholar
  5. Day C. Metabolic syndrome, or what you will: definitions and epidemiology. Diab Vasc Dis Res. 2007;4:32–8.View ArticlePubMedGoogle Scholar
  6. Zhuo Q, Yang W, Chen J, Wang Y. Metabolic syndrome meets osteoarthritis. Nat Rev Rheumatol. 2012;8:729–37.View ArticlePubMedGoogle Scholar
  7. Maxfield FR, Tabas I. Role of cholesterol and lipid organization in disease. Nature. 2005;438:612–21.View ArticlePubMedGoogle Scholar
  8. Simopoulou T, Malizos KN, Iliopoulos D, Stefanou N, Papatheodorou L, Ioannou M, et al. Differential expression of leptin and leptin’s receptor isoform (Ob-Rb) mRNA between advanced and minimally affected osteoarthritic cartilage; effect on cartilage metabolism. Osteoarthritis Cartilage. 2007;15:872–83.View ArticlePubMedGoogle Scholar
  9. Simopoulou T, Malizos KN, Tsezou A. Lectin-like oxidized low density lipoprotein receptor 1 (LOX-1) expression in human articular chondrocytes. Clin Exp Rheumatol. 2007;25:605–12.PubMedGoogle Scholar
  10. Tsezou A, Iliopoulos D, Malizos KN, Simopoulou T. Impaired expression of genes regulating cholesterol efflux in human osteoarthritic chondrocytes. J Orthop Res. 2010;28:1033–9.PubMedGoogle Scholar
  11. Kostopoulou F, Gkretsi V, Malizos KN, Iliopoulos D, Oikonomou P, Poultsides L, et al. Central role of SREBP-2 in the pathogenesis of osteoarthritis. PLoS One. 2012;7:e35753.View ArticlePubMed CentralPubMedGoogle Scholar
  12. Alvarez-Garcia I, Miska EA. MicroRNA functions in animal development and human disease. Development. 2005;132:4653–62.View ArticlePubMedGoogle Scholar
  13. Bartel DP. MicroRNAs: genomics, biogenesis, mechanism, and function. Cell. 2004;116:281–97.View ArticlePubMedGoogle Scholar
  14. Bartel DP. MicroRNAs: target recognition and regulatory functions. Cell. 2009;136:215–33.View ArticlePubMed CentralPubMedGoogle Scholar
  15. Shin C, Nam JW, Farh KK, Chiang HR, Shkumatava A, Bartel DP. Expanding the microRNA targeting code: functional sites with centered pairing. Mol Cell. 2010;38:789–802.View ArticlePubMed CentralPubMedGoogle Scholar
  16. Akhtar N, Rasheed Z, Ramamurthy S, Anbazhagan AN, Voss FR, Haqqi TM. MicroRNA-27b regulates the expression of matrix metalloproteinase 13 in human osteoarthritis chondrocytes. Arthritis Rheum. 2010;62:1361–71.View ArticlePubMed CentralPubMedGoogle Scholar
  17. Dunn W, DuRaine G, Reddi AH. Profiling microRNA expression in bovine articular cartilage and implications for mechanotransduction. Arthritis Rheum. 2009;60:2333–9.View ArticlePubMedGoogle Scholar
  18. Miyaki S, Sato T, Inoue A, Otsuki S, Ito Y, Yokoyama S, et al. MicroRNA-140 plays dual roles in both cartilage development and homeostasis. Genes Dev. 2010;24:1173–85.View ArticlePubMed CentralPubMedGoogle Scholar
  19. Yu C, Chen WP, Wang XH. MicroRNA in osteoarthritis. J Int Med Res. 2011;39:1–9.View ArticlePubMedGoogle Scholar
  20. Iliopoulos D, Malizos KN, Oikonomou P, Tsezou A. Integrative microRNA and proteomic approaches identify novel osteoarthritis genes and their collaborative metabolic and inflammatory networks. PLoS One. 2008;3:e3740.View ArticlePubMed CentralPubMedGoogle Scholar
  21. Kim SY, Kim AY, Lee HW, Son YH, Lee GY, Lee JW, et al. miR-27a is a negative regulator of adipocyte differentiation via suppressing PPARγ expression. Biochem Biophys Res Commun. 2010;392:323–8.View ArticlePubMedGoogle Scholar
  22. Ramírez CM, Goedeke L, Fernández-Hernando C. “Micromanaging” metabolic syndrome. Cell Cycle. 2011;10:3249–52.View ArticlePubMed CentralPubMedGoogle Scholar
  23. Marquart TJ, Allen RM, Ory DS, Baldan A. miR-33 links SREBP-2 induction to repression of sterol transporters. Proc Natl Acad Sci U S A. 2010;107:12228–32.View ArticlePubMed CentralPubMedGoogle Scholar
  24. Najafi-Shoushtari SH, Kristo F, Li Y, Shioda T, Cohen DE, Gerszten RE, et al. MicroRNA-33 and the SREBP host genes cooperate to control cholesterol homeostasis. Science. 2010;328:1566–9.View ArticlePubMedGoogle Scholar
  25. Rayner KJ, Suárez Y, Dávalos A, Parathath S, Fitzgerald ML, Tamehiro N, et al. MiR-33 contributes to the regulation of cholesterol homeostasis. Science. 2010;328:1570–3.View ArticlePubMed CentralPubMedGoogle Scholar
  26. Norata GD, Sala F, Catapano AL, Fernández-Hernando C. MicroRNAs and lipoproteins: a connection beyond atherosclerosis? Atherosclerosis. 2013;227:209–15.View ArticlePubMed CentralPubMedGoogle Scholar
  27. Dávalos A, Goedeke L, Smibert P, Ramírez CM, Warrier NP, Andreo U, et al. miR-33a/b contribute to the regulation of fatty acid metabolism and insulin signaling. Proc Natl Acad Sci U S A. 2011;108:9232–7.View ArticlePubMed CentralPubMedGoogle Scholar
  28. Gerin I, Clerbaux LA, Haumont O, Lanthier N, Das AK, Burant CF, et al. Expression of miR-33 from an SREBP2 intron inhibits cholesterol export and fatty acid oxidation. J Biol Chem. 2010;285:33652–61.View ArticlePubMed CentralPubMedGoogle Scholar
  29. Horie T, Ono K, Horiguchi M, Nishi H, Nakamura T, Nagao K, et al. MicroRNA-33 encoded by an intron of sterol regulatory element-binding protein 2 (Srebp2) regulates HDL in vivo. Proc Natl Acad Sci U S A. 2010;107:17321–6.View ArticlePubMed CentralPubMedGoogle Scholar
  30. Rayner KJ, Esau CC, Hussain FN, McDaniel AL, Marshall SM, van Gils JM, et al. Inhibition of miR-33a/b in non-human primates raises plasma HDL and lowers VLDL triglycerides. Nature. 2011;478:404–7.View ArticlePubMed CentralPubMedGoogle Scholar
  31. Rayner KJ, Sheedy FJ, Esau CC, Hussain FN, Temel RE, Parathath S, et al. Antagonism of miR-33 in mice promotes reverse cholesterol transport and regression of atherosclerosis. J Clin Invest. 2011;121:2921–31.View ArticlePubMed CentralPubMedGoogle Scholar
  32. TargetScan 6.2. http://www.targetscan.org/. Accessed 12 Mar 2015.
  33. miRanda. http://www.microrna.org/microrna/home.do. Accessed 12 Mar 2015.
  34. miRDB. http://mirdb.org/mirdb/. Accessed 12 Mar 2015.
  35. Chen C, Ridzon DA, Broomer AJ, Zhou Z, Lee DH, Nguyen JT, et al. Real-time quantification of microRNAs by stem-loop RT-PCR. Nucleic Acids Res. 2005;33:e179.View ArticlePubMed CentralPubMedGoogle Scholar
  36. Iwakiri Y. A role of miR-33 for cell cycle progression and cell proliferation. Cell Cycle. 2012;11:1057–8.View ArticlePubMedGoogle Scholar
  37. Gkretsi V, Simopoulou T, Tsezou A. Lipid metabolism and osteoarthritis: lessons from atherosclerosis. Prog Lipid Res. 2011;50:133–40.View ArticlePubMedGoogle Scholar
  38. Simopoulou T, Malizos KN, Poultsides L, Tsezou A. Protective effect of atorvastatin in cultured osteoarthritic chondrocytes. J Orthop Res. 2010;28:110–5.PubMedGoogle Scholar
  39. Wu J, Liu W, Bemis A, Wang E, Qiu Y, Morris EA, et al. Comparative proteomic characterization of articular cartilage tissue from normal donors and patients with osteoarthritis. Arthritis Rheum. 2007;56:3675–84.View ArticlePubMedGoogle Scholar
  40. Gao X, Qiao Y, Han D, Zhang Y, Ma N. Enemy or partner: relationship between intronic microRNAs and their host genes. IUBMB Life. 2012;64:835–40.View ArticlePubMedGoogle Scholar
  41. Lamouille S, Derynck R. Cell size and invasion in TGF-β-induced epithelial to mesenchymal transition is regulated by activation of the mTOR pathway. J Cell Biol. 2007;178:437–51.View ArticlePubMed CentralPubMedGoogle Scholar
  42. Zhang L, Zhou F, ten Dijke P. Signaling interplay between transforming growth factor-β receptor and PI3K/AKT pathways in cancer. Trends Biochem Sci. 2013;38:612–20.View ArticlePubMedGoogle Scholar
  43. Chen J, Crawford R, Xiao Y. Vertical inhibition of the PI3K/Akt/mTOR pathway for the treatment of osteoarthritis. J Cell Biochem. 2013;114:245–9.View ArticlePubMedGoogle Scholar
  44. Krycer JR, Sharpe LJ, Luu W, Brown AJ. The Akt–SREBP nexus: cell signaling meets lipid metabolism. Trends Endocrinol Metab. 2010;21:268–76.View ArticlePubMedGoogle Scholar
  45. Li ZJ, Ou-Yang PH, Han XP. Profibrotic effect of miR-33a with Akt activation in hepatic stellate cells. Cell Signal. 2014;26:141–8.View ArticlePubMedGoogle Scholar
  46. Asano Y, Ihn H, Yamane K, Kubo M, Tamaki K. Impaired Smad7-Smurf-mediated negative regulation of TGF-β signaling in scleroderma fibroblasts. J Clin Invest. 2004;113:253–64.View ArticlePubMed CentralPubMedGoogle Scholar
  47. Halder SK, Beauchamp RD, Datta PK. Smad7 induces tumorigenicity by blocking TGF-β-induced growth inhibition and apoptosis. Exp Cell Res. 2005;307:231–46.View ArticlePubMedGoogle Scholar
  48. Yan X, Liu Z, Chen Y. Regulation of TGF-β signaling by Smad7. Acta Biochim Biophys Sin. 2009;41:263–72.View ArticlePubMedGoogle Scholar
  49. Huang CF, Sun CC, Zhao F, Zhang YD, Li DJ. miR-33a levels in hepatic and serum after chronic HBV-induced fibrosis. J Gastroenterol. In press. doi:https://doi.org/10.1007/s00535-014-0986-3.

Copyright

© Kostopoulou et al.; licensee BioMed Central. 2015

This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated.

Advertisement